Still in progress, but here are the data I do have!

 


Hey all, 

It’s been a while since my last update, and the pandemic has severely limited my lab work within the last year. I still don’t have all the data I need for my purposes, but I do have some data that kind people who sent me samples might be interested in: Russulaceae DNA barcodes from ten of the community-sourced samples. I thought I’d provide those for anyone who wants them and explain next steps. They’ll be in a list below the text with initials of the collector and state collected, so you can find your sample if it’s one of the few I’ve successfully sequenced. I’ll explain what you can do with your sequence, if desired.

These DNA sequences are from Sanger sequencing, which is the most basic and “traditional” type of sequencing. This only allows me to sequence one version of the DNA barcode (ITS) at a time. This process requires me to PCR-amplify the ITS region of DNA so there are many, many copies of the same sequence. PCR, the process that allows me to copy the sequence using a DNA-replicating enzyme, involves “primers”, which are small sequences of DNA that bind to the target sequence and tell the enzyme where to begin copying. Primers can be more or less taxonomically specific. The ones I’ve been using are very general, and obviously I’ve had limited success. To obtain more sequences of Russulaceae hosts and Hypomyces parasites, I’m going to be ordering primers that are specific to these two groups, and I expect that this will work a lot better. It was initially surprising to me that obtaining Russulaceae and Hypomyces sequences was so difficult, especially Hypomyces, because I’d expect those two fungi to be the most abundant in the sample, but it’s become clear to me that these specific primers will be necessary. 

One other thing I tried that was even less successful than Sanger: metabarcoding. This is a process that uses PCR to amplify the barcode region, like Sanger, but then sequences many different versions of the barcode region, not just one. The sequencing technology is the same short-read method used for genomes. Using general primers, I was hoping to see not only Russulaceae and Hypomyces, but also other fungi that were living within the sporocarp. (This would have been unreliable for assessing the fungal community of dried samples, because things could have grown on them during/after preservation, but I was planning on using some samples I collected in nucleic acid preservation buffer for more serious assessment). Basically, I only got junk, which is frustrating. 

My problems with failing to amplify and sequence my two target taxa could be down to a few different things, including incomplete lysis (breakage) of Hypomyces hyphal material specifically, or the DNA flanking the ITS barcoding region where my primers should anneal having a lower affinity (a worse match in DNA bases) for the primers in Russulaceae and Hypomyces. For metabarcoding, it’s possible that preferential amplification based on superior primer affinity in other taxa literally swamped out my desired sequences in copy number.

YOUR SEQUENCES! (Or, rather, ten of them). Initials and collection location are entered above their corresponding sequence. Instructions for running sequences through the NCBI website’s BLAST function to ID them are provided below the sequences.

Initials: SE
Collected in: Pennsylvania

>LM1
CATTATCGTACAATGGGGGTACGACGGCTGTCGCTGACTTTTATGGTCGTGCACGCCCGAGTGCTCTCACATACAAACATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCCTTCCTCGGAGGGGGGKGCTCMCGTTTTTAACATTAAACACCCATCCGAACGTATCGTAAAATGKTCTTTGCGCGATCACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGKGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGKCGTGAACGTACTCAACCTGCTTGGTTTTATCGAACCGAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATCTATCAGTGGGATCCGCTTTGCTAGATCCTCSACGTTGATAAGATGTTTCTACSTCTTGGGTTTCGCTCGGGAAAGGACCTGCTTCCAACCGTCCCATCGAGGACATCGTTCGAGCCGATCGCCCTTCACGGGGTGAAAAGCTTTTCGACCCATCATACCTTGACCT

Initials: IH
Collected in: New York

>LM16-B
CATTATCGTACAATGGGGGTACGAAGGCTGTCGCTGACTTTTTGTCGTGCACGCCCGAGTGCTCTCACATACAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCTTCCTCGGAGGGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTAGTGTAGAATGWTCTTTGCGCGATCACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTACCGAACCAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATGTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGATTTCGCTTGGGAAGGAACCTGCTTCTAACCGTCCCATCAGGGACAATGTTCAAGCCGATCGCCCTTCACGGGGTGGGAAGCTTTCGACCCATGAAACCTTGACCT

Initials: IH
Collected in: New York

>LM17
CATTATCGTACATGGGGGTACGAAGGCTGTCGCTGACTTTTTGTCGTGCACGCCCGAGTGCTCTCACATACAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCTTCCTCGGAGGGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTAGTGTAGAATGTTCTTTGCGCGATCACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTACCGAACCAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATGTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGATTTCGCTCGGGAAGGAACCTGCTTCTAACCGTCCCATCAGGGACAATGTTCAAGCCGATCGCCCTTCACGGGGTGGGAAGCTTTCGACCCATGAAACCTTGACCT

Initials: IH
Collected in: New York

>LM18
CATGGGGGTACGAAGGCTGTCGCTGACTTTTTGTTGTGCACGCCCGAGTGCTCTCACATACAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCTTCCTCGGAGGGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTAGTGTAGAATGTTCTTTGCGCGATCACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTACCGAACCAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATGTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGATTTCGCTCGGGAAGGAACCTGCTTCTAACCGTCCCATCAGGGACAATGTTCAAGCCGATCGCCCTTCACGGGGTGGGAAGCTTTYGACCCATGAAACCTTGACCT

Initials: AN
Collected in: Minnesota

>LM19
CATTAATGATTTGAAGGAGTTTTGTTGCTGGCTTGTCAACCCAGGCATGTGCACACTCCGATCTCATCCATCTTACACCTGTGCACCCTTGCGTGGGTCTGTCGGCTTTGCGGTCGTTCGGGCTTGCGTTTTTTCTATAAACTTTTATGTATGTAACAGAATGTCTTAAATGCTATAAACGCATCTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACGCCTGTTCGAGTGTCGTGAAATTCTCAACTCAGTCCTCTTGTTATGAGAGGGCTGGGCTTGGACTTGGAGGTCTTGCCGGTGGTTCCTTCGGGACCGTCGGCTCCTCTTGAATGCATGAGTGGATCCCTTTTTGTAGGGTTTGCCCTTGGTGTGATAATTATCTATGCCGCGGGTAGCCTTGCGCGCTGGTCTGCTTCTAACCGTCCTTCGGGACATGTTTTTCATCTCAACTTGACCTCGAATCAGGCGGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAT

Initials: ABC
Collected in: Minnesota

>LM20
CATTAWCGTACGATGGGGGTACGACGGCTGTCGCTGACTTTTATGGTCGTGCACGCCCGAGTGCTCTCACATACAAACATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCTTCCTCGGAGGGGGGTGCTCACGTTTTTAACATCGAACACCCCATTCGAACGTATTGTAGAATGTTCTTTGCGCGATGACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTCGGTTTTATCGAACCAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATCTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGGTTTCGCTCGGGAAGGACCTGCTTCTAACCGTCCCCATCGGGGACATCGTTCGAGCCGATCGCCCTTCACGGGGTGGGAAGCTTTTCGAACCCATGAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAT

Initials: BB
Collected in: Minnesota

>LM28
RTTATACGTACATGGGGGTACGACGGCTGTCGCTGACTTTTATGGTTGTGCACSCCCGAGTGCTCTCACATACAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCCTTCCTCGGAGGGGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTATTGTAGAATGTTCTTTGCGCGATGACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTACTGAACCAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATCTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGGTTTCGCTCGGGAAAGGACCTGCTTCCAACYGTCCCATCGAGGACATCGTTCGAGCYGATCGCCCTTCACGGGGTGAGAAGCTTTTCGACCCATCGAACCTTGACCT

Initials: BB
Collected in: Minnesota

>LM29
CATTATCGTACATGGGGGCACCGGGGCTGTCGCTGACTTTTAATGTCGTGCACGCCCCGAGTGCTCTCACATACAAAATATCCATCTCACCCCTTTGTGCATCACCGGCGTGGGTTTTCCCCCCTCTTCCTTCCTCGGAGGGGGCGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTAATGTAGAATGTTCTTTGTGCGATCACGCACGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTTTTT

Initials: BB
Collected in: Minnesota

>LM30
CATTATCGTACAATGGGGGTACGACGGCTGTCGCTGACTTTTATGGTYGTGCACGCCCGAGTGCTCTCACATACAAATATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCCTTCCTCGGAGGGGGGTGCTCACGTTTTTAACATTAAACACCCATTCGAACGTATTGTAGAATGTTCTTTGCGCGATGACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTACTGAACCAAGTAGGCTTGGAATTTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATCTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGGTTTYGCTCGGGAAAGGACCTGCTTCCAACCGTCCCATCGAGGACATCGTTCRAGCCGATCGCCCTTCACGGGGTGAGAAGCTTTTCGACCCATCGAACCTTGACCT

Initials: BB
Collected in: Minnesota

>LM31
CATTATCGTACATGGGGGTACGACGGCTGTCGCTGACTTTAGTCGTGCACGCCCGAGTGCTCTCACATACAAATATCCATCCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCTTCCTCGGAGGGGGGTGCTCACGTTTTTAACATCAAACACCCATTCGAACGTAATGTAGAATGTTCTTTGTGCGATGACGCGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAACATCCTCAACCTGCTTGGTTTTATCGAACCAAGTAGGCTTGGAATCTGGAGGTTTTCTGCTGGCCTCCTCCGAAGCCAGCTCCTCTTAAATGTATCAGTGGGATCCGCTTTGCTAGATCCTCGACGTTGATAAGATGTTTCTACGTCTTGGGTTTTGCTCGGGAAGGACCTGCTTCTAACCGTCCCAATCGGGGACAACGTTCGAGCCGATCGCCCTTCATGGGGTGGGAAGCTTTTCGACCCATGAAACCTTGACCT

How to use BLAST

BLAST is a tool to match a DNA sequence with a sequence from the NCBI database. It’s a good way to quickly check what your sequence might belong to, but it’s only as reliable as the labeling of the sequences in the database. Unfortunately, Russulaceae is a group with very complicated taxonomy and it’s likely that some of the sequences in this database are mislabeled and/or would be classified under a different name due to recent taxonomic revisions. However, if someone entered a sequence into a database under Russula brevipes, it’s likely because the specimen looked a lot like a brevipes to them, and might match your personal concept of brevipes as a hands-on forager. 

1. Go to https://blast.ncbi.nlm.nih.gov/Blast.cgi in your web browser.
2. Click on the large “Nucleotide BLAST” button to the left of the page.
3. In the large text field under “Enter Query Sequence”, paste your sequence. You can keep the carrot and my specimen ID at the top (>LM1, for example) or not, it doesn’t matter if you’re only BLASTing one sequence at a time. 
4. At the lower left side of the page, press the blue button that says BLAST. Your sequence may take several minutes to search.
5. Once you have the results, your page will display the top 100 most similar database hits to your sequence. The Query Cover column will tell you if your top hit(s) match with all of your sequence, or just part. The Percent Identity column will tell you how similar your sequence is to a database hit, but with a low Query Cover a high Percent Identity isn’t meaningful.  

Comments

Post a Comment

Popular posts from this blog

Host identities and other exciting updates

Image
Hey everyone, I’m getting closer to answering several of my main questions. Here are the ones I can begin to address with this blog post: 1) What are the hosts of Hypomyces lactifluorum , the lobster mushroom mold parasite? 2) Do genetic lineages of the parasite specialize on different host species? 3) Is the white lobster mushroom, named as the separate species Hypomyces macrosporus without DNA data, really its own species or just a color morph of H. lactifluorum ? I’ve had to use a hodgepodge of techniques to obtain enough parasite and host DNA to use for this project, including Sanger sequencing (the more “old-fashioned” sequencing technique) of the ITS gene, Illumina high-throughput sequencing to metabarcode the ITS gene, and whole-genome Illumina high-throughput sequencing. Different techniques worked for different samples, and I have very few clues as to why I found this variation. Just a few more mysteries to throw on the huge pile of fascinating questions in fungal genet...
Read more

What is this?

Image
Hello, and welcome to the Community-based Lobster Acquisition Workforce (C.L.A.W.)! This is a project I’m conducting with the hope of learning more about the biology of lobster mushrooms. I’m an Ecology, Evolution, and Organismal Biology PhD student in a mycology lab at the University of Utah in Salt Lake City (incidentally, no lobster specimens have been recorded from the state of Utah, although the common host Russula brevipes occurs here). My interest in fungi actually started with lichens while I was an undergrad, and has expanded to include all sorts of fungal phenomena. I’m especially interested in insect-fungus interactions, as well as mycoparasitism (fungi parasitizing other fungi). At this point, I’m still at the beginning of my graduate work and exploring several different possible directions for the research that will become my thesis, as well as learning a lot about mushrooms!             “Lobster mushro...
Read more

Some very preliminary results

Image
Early in the DNA extraction process--differently colored lobsters produce different hues of lobster juice I've gotten some interest recently in what I've been able to accomplish with everyone's samples over the last nearly a year. I've received 31 donations of dried lobster mushroom or uninfected host samples from super generous people and was able to collect further samples of my own in Oregon. Through a combination of "things always take longer than you think" and activities for my thesis, I've only been able to fully process a few samples. My thesis is actually a project about fungus-farming ants, rather than lobster mushrooms, but the two study systems are united by the presence of a fungal parasite in each that are both in the same taxonomic order (so, fairly closely related, in the grand scheme of fungal diversity)-- Hypomyces lactifluorum attacking lobster mushroom hosts, and Escovopsis attacking the fungal crop of ant farmers, both in the ord...
Read more